Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012453960

Mus musculus and Rattus norvegicus STS probe RH132942 for 5-hydroxytryptamine (serotonin) receptor 1D (Htr1d) and 1 more gene

Synopsis

Field NameValues
NameRH132942
AliasesAI535474
TypeSTS
Application
Source organism
Source sequence
Target organismsMus musculus; Rattus norvegicus
Target genesHtr1d (Mus musculus); Htr1d (Rattus norvegicus)

Sequences

>Probe|12453960|PRIMERF Forward PCR primer (outermost) (22b)
TGGCAGTCAAACACAGAACAAA
>Probe|12453960|PRIMERR Reverse PCR primer (outermost) (22b)
TCGACAAGCGTTTCAGAGAGTC

References

1.

High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence.

Kwitek AE, Gullings-Handley J, Yu J, Carlos DC, Orlebeke K, Nie J, Eckert J, Lemke A, Andrae JW, Bromberg S, Pasko D, Chen D, Scheetz TE, Casavant TL, Soares MB, Sheffield VC, Tonellato PJ, Jacob HJ.

Genome Res. 2004 Apr;14(4):750-7.

2.

A high-density integrated genetic linkage and radiation hybrid map of the laboratory rat.

Steen RG, Kwitek-Black AE, Glenn C, Gullings-Handley J, Van Etten W, Atkinson OS, Appel D, Twigger S, Muir M, Mull T, Granados M, Kissebah M, Russo K, Crane R, Popp M, Peden M, Matise T, Brown DM, Lu J, Kingsmore S, Tonellato PJ, Rozen S, Slonim D, Young P, Jacob HJ.

Genome Res. 1999 Jun;9(6):AP1-8, insert. Genome Res 1999 Aug;9(8):793.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Rattus norvegicusradiation hybridMCW RH51004.2 crAI535474

Computational maps for probe

Analysis is pending.

Additional Data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk