Display Settings:

Format

Send to:

Choose Destination
Pr012453854

Homo sapiens STS probe SHGC-6067

Synopsis

Field NameValues
NameSHGC-6067
AliasesRH42764
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
UniSTS IDUniSTS:21613

Sequences

>Probe|12453854|PRIMERF Forward PCR primer (outermost) (20b)
ATTTGAACTGAGTCTTGGCA
>Probe|12453854|PRIMERR Reverse PCR primer (outermost) (21b)
CTTTTCTCTGAACCAAGCTTC

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G383904 cr10000SHGC-6067
Homo sapienslinkageRutgers Map8 cmSHGC-6067

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID21613
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk