Display Settings:

Format

Send to:

Choose Destination
Pr012445540

STS probe D11S4089 for tectorin alpha (TECTA) and 4 more genes

Synopsis

Field NameValues
NameD11S4089
AliasesA162WF5; AFMA162WF5; AFMa162wf5; HSA162WF5; W5547
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesTECTA; TECTA; TECTA; TECTA; TECTA
UniSTS IDUniSTS:20864

Sequences

>Probe|12445540|PRIMERF Forward PCR primer (outermost) (25b)
ATTCCTAGTTCCCTCATAAACACTG
>Probe|12445540|PRIMERR Reverse PCR primer (outermost) (24b)
TAATCAAAGGCTGTAGTGAATTGG

References

1.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

2.

A high-resolution recombination map of the human genome.

Kong A, Gudbjartsson DF, Sainz J, Jonsdottir GM, Gudjonsson SA, Richardsson B, Sigurdardottir S, Barnard J, Hallbeck B, Masson G, Shlien A, Palsson ST, Frigge ML, Thorgeirsson TE, Gulcher JR, Stefansson K.

Nat Genet. 2002 Jul;31(3):241-7. Epub 2002 Jun 10.

Show All 3 References...

3.

A comprehensive genetic map of the human genome based on 5,264 microsatellites.

Dib C, Fauré S, Fizames C, Samson D, Drouot N, Vignal A, Millasseau P, Marc S, Hazan J, Seboun E, Lathrop M, Gyapay G, Morissette J, Weissenbach J.

Nature. 1996 Mar 14;380(6570):152-4.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map11 cmD11S4089
Homo sapienslinkageMarshfield11119.07 cmAFMa162wf5
Homo sapienslinkagedeCODE11124.37 cmD11S4089
Homo sapienslinkageGenethon11123.6 cmAFMa162wf5

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID20864
Probe Cross-refcontext specific help for: Probe Cross-refGDB:603905
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk