Display Settings:

Format

Send to:

Choose Destination
Pr012440034

STS probe D12S1832 for guanylate cyclase 2C (GUCY2C) and 4 more genes

Synopsis

Field NameValues
NameD12S1832
AliasesRH35351; SHGC-9278
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesGUCY2C; GUCY2C; GUCY2C; GUCY2C; GUCY2C
UniSTS IDUniSTS:20368

Sequences

>Probe|12440034|PRIMERF Forward PCR primer (outermost) (20b)
ATGTTGGTTCCCTTTTTCCC
>Probe|12440034|PRIMERR Reverse PCR primer (outermost) (21b)
TTCTGTCCTACCACCATGAGG

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G312802 cr10000SHGC-9278
Homo sapienslinkageRutgers Map12 cmD12S1832

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID20368
Probe Cross-refcontext specific help for: Probe Cross-refGDB:638152
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk