Display Settings:

Format

Send to:

Choose Destination
Pr012438935

STS probe G33146 for succinate dehydrogenase [ubiquinone] flavoprotein subunit, mitochondrial-like (LOC471046) and 5 more genes

Synopsis

Field NameValues
NameG33146
AliasesSHGC-11056
TypeSTS
Application
Source organism
Source sequence
Target genesSDHA; LOC100438237; LOC100452460; LOC100457577; LOC471046; LOC750856
UniSTS IDUniSTS:20269

Sequences

>Probe|12438935|PRIMERF Forward PCR primer (outermost) (22b)
ATGTGGTGATGACAGAATCAGC
>Probe|12438935|PRIMERR Reverse PCR primer (outermost) (18b)
TCCCCAGAGTGCAGAAGC

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID20269
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk