Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012438902

Homo sapiens STS probe D11S4663 for hypothetical protein LOC646413 (LOC646413) and 1 more gene

Synopsis

Field NameValues
NameD11S4663
AliasesRH29729; SHGC-14404
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC646413 (Homo sapiens); LOC652232 (Homo sapiens)

Sequences

>Probe|12438902|PRIMERF Forward PCR primer (outermost) (20b)
ATGTGGTATCCTCCTTCCCC
>Probe|12438902|PRIMERR Reverse PCR primer (outermost) (21b)
GGTGTGCACAGTGTGATTTTG

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G3111951 cr10000SHGC-14404
Homo sapienslinkageRutgers Map11 cmD11S4663

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID20266
Probe Cross-refcontext specific help for: Probe Cross-refGDB:740513
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk