Display Settings:

Format

Send to:

Choose Destination
Pr012438580

Eukaryota (5 taxa) STS probe AL009667 for cholinergic receptor, muscarinic 3 (CHRM3) and 7 more genes

Synopsis

Field NameValues
NameAL009667
AliasesstSG32513FS
TypeSTS
Application
Source organism
Source sequence
Target organismsNomascus leucogenys; Macaca mulatta; Pan troglodytes; Pongo abelii; Homo sapiens
Target genesCHRM3 (Pongo abelii); CHRM3 (Nomascus leucogenys); CHRM3 (Homo sapiens); CHRM3 (Pan troglodytes); LOC653674 (Homo sapiens); LOC654136 (Homo sapiens); CHRM3 (Macaca mulatta); LOC730413 (Homo sapiens)
UniSTS IDUniSTS:20237

Sequences

>Probe|12438580|PRIMERF Forward PCR primer (outermost) (20b)
ATGTGCTGCAAACCACTCTG
>Probe|12438580|PRIMERR Reverse PCR primer (outermost) (18b)
GAGGGTCGGAGACCAGGT

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map1 cmAL009667

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID20237
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk