Display Settings:

Format

Send to:

Choose Destination
Pr012433836

STS probe SHGC-32035 for gamma-aminobutyric acid (GABA) B receptor, 2 (GABBR2) and 4 more genes

Synopsis

Field NameValues
NameSHGC-32035
AliasesEST229141; RH14799; SGC32035
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100448699; GABBR2; GABBR2; GABBR2; GABBR2
UniSTS IDUniSTS:1981

Sequences

>Probe|12433836|PRIMERF Forward PCR primer (outermost) (22b)
AAATCGATACCATGCAGTAGGG
>Probe|12433836|PRIMERR Reverse PCR primer (outermost) (18b)
AGAGGCTTCGGCCTGAAG

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Show All 4 References...

3.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

4.

An STS-based map of the human genome.

Hudson TJ, Stein LD, Gerety SS, Ma J, Castle AB, Silva J, Slonim DK, Baptista R, Kruglyak L, Xu SH, Hu X, Colbert AM, Rosenberg C, Reeve-Daly MP, Rozen S, Hui L, Wu X, Vestergaard C, Wilson KM, Bae JS, Maitra S, Ganiatsas S, Evans CA, DeAngelis MM, Ingalls KA, Nahf RW, Horton LT Jr, Anderson MO, Collymore AJ, Ye W, Kouyoumjian V, Zemsteva IS, Tam J, Devine R, Courtney DF, Renaud MT, Nguyen H, O'Connor TJ, Fizames C, Fauré S, Gyapay G, Dib C, Morissette J, Orlin JB, Birren BW, Goodman N, Weissenbach J, Hawkins TL, Foote S, Page DC, Lander ES.

Science. 1995 Dec 22;270(5244):1945-54.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G393382 cr10000SHGC-32035
Homo sapiensradiation hybridGeneMap99-G393280 cr10000SHGC-32035
Homo sapienslinkageRutgers Map9 cmSHGC-32035
Homo sapiensradiation hybridNCBI RH9830.1 crSHGC-32035
Homo sapiensradiation hybridWhitehead-RH9360.3 cr3000SGC32035

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID1981
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk