Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012433136

Homo sapiens STS probe D3S2346

Synopsis

Field NameValues
NameD3S2346
AliasesMR234; SX_50_24.SEQ; WI-1347
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens

Sequences

>Probe|12433136|PRIMERF Forward PCR primer (outermost) (20b)
ATGGAGACAACTGCCTGAAG
>Probe|12433136|PRIMERR Reverse PCR primer (outermost) (21b)
GAAGTACCCTGTCTCATTCCA

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map3 cmD3S2346

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID19747
Probe Cross-refcontext specific help for: Probe Cross-refGDB:354854
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk