Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012433125

Homo sapiens STS probe G31137 for protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2 (PPFIA2)

Synopsis

Field NameValues
NameG31137
AliasesSHGC-50025
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genePPFIA2 (Homo sapiens)

Sequences

>Probe|12433125|PRIMERF Forward PCR primer (outermost) (21b)
ATGGAGAATAGGACCAGCACA
>Probe|12433125|PRIMERR Reverse PCR primer (outermost) (25b)
TGGATTTTAAAGTAGCTTTAATTGG

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID19746
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk