Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012430003

Eukaryota (5 taxa) STS probe D12S1908 for LIM domain and actin binding 1 (LIMA1) and 4 more genes

Synopsis

Field NameValues
NameD12S1908
AliasesRH8796; SHGC-14654
TypeSTS
Application
Source organism
Source sequence
Target organismsNomascus leucogenys; Macaca mulatta; Pan troglodytes; Pongo abelii; Homo sapiens
Target genesLIMA1 (Pongo abelii); LIMA1 (Nomascus leucogenys); LIMA1 (Pan troglodytes); LIMA1 (Homo sapiens); LIMA1 (Macaca mulatta)

Sequences

>Probe|12430003|PRIMERF Forward PCR primer (outermost) (24b)
ATGCAGTACAAAGAAAAGCCTACA
>Probe|12430003|PRIMERR Reverse PCR primer (outermost) (25b)
TTGGGATGATTTTCTAGTCTTAAGG

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G3122000 cr10000SHGC-14654
Homo sapiensradiation hybridGeneMap99-G3121946 cr10000SHGC-14654
Homo sapienslinkageRutgers Map12 cmD12S1908

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID19465
Probe Cross-refcontext specific help for: Probe Cross-refGDB:675859; GDB:676723
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk