Display Settings:

Format

Send to:

Choose Destination
Pr012428926

Homo sapiens STS probe AL023917

Synopsis

Field NameValues
NameAL023917
AliasesDJ1014O12T7; stSG50082
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
UniSTS IDUniSTS:19368

Sequences

>Probe|12428926|PRIMERF Forward PCR primer (outermost) (22b)
ATGATGTGATGAACATGAAGGC
>Probe|12428926|PRIMERR Reverse PCR primer (outermost) (18b)
CAGATGATTTGGGGCAGG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers MapX cmAL023917

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID19368
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk