Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012419612

Eukaryota (3 taxa) STS probe SHGC-171779 for T cell receptor alpha locus (TRA) and 6 more genes

Synopsis

Field NameValues
NameSHGC-171779
TypeSTS
Application
Source organism
Source sequence
Target organismsPan troglodytes; Pongo abelii; Homo sapiens
Target genesLOC100460437 (Pongo abelii); TRDV1 (Homo sapiens); TRAJ17 (Homo sapiens); LOC452780 (Pan troglodytes); LOC452781 (Pan troglodytes); TRA (Homo sapiens); TRD (Homo sapiens)

Sequences

>Probe|12419612|PRIMERF Forward PCR primer (outermost) (23b)
TTTCCCTACCACCTCATGTCACT
>Probe|12419612|PRIMERR Reverse PCR primer (outermost) (23b)
CCAGCTTCCCTTCATTTTTCTTT

References

1.

A high-resolution radiation hybrid map of the human genome draft sequence.

Olivier M, Aggarwal A, Allen J, Almendras AA, Bajorek ES, Beasley EM, Brady SD, Bushard JM, Bustos VI, Chu A, Chung TR, De Witte A, Denys ME, Dominguez R, Fang NY, Foster BD, Freudenberg RW, Hadley D, Hamilton LR, Jeffrey TJ, Kelly L, Lazzeroni L, Levy MR, Lewis SC, Liu X, Lopez FJ, Louie B, Marquis JP, Martinez RA, Matsuura MK, Misherghi NS, Norton JA, Olshen A, Perkins SM, Perou AJ, Piercy C, Piercy M, Qin F, Reif T, Sheppard K, Shokoohi V, Smick GA, Sun WL, Stewart EA, Fernando J, Tejeda, Tran NM, Trejo T, Vo NT, Yan SC, Zierten DL, Zhao S, Sachidanandam R, Trask BJ, Myers RM, Cox DR.

Science. 2001 Feb 16;291(5507):1298-302.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridTNG141569 cr50000SHGC-171779
Homo sapienslinkageRutgers Map14 cmSHGC-171779

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID185292
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk