Display Settings:

Format

Send to:

Choose Destination
Pr012415757

STS probe G65049 for disrupted in schizophrenia 1 (DISC1) and 4 more genes

Synopsis

Field NameValues
NameG65049
AliasesDISC1_5'_Microsatellite
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesTSNAX-DISC1; LOC100453740; DISC1; DISC1; DISC1
UniSTS IDUniSTS:181821

Sequences

>Probe|12415757|PRIMERF Forward PCR primer (outermost) (27b)
CCAGAAATGAGTCAGAGTGAAAGCAAA
>Probe|12415757|PRIMERR Reverse PCR primer (outermost) (25b)
GCTCCTTTCTTCTCCTCAGCGAGTC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map1 cmG65049

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID181821
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk