Display Settings:

Format

Send to:

Choose Destination
Pr012415736

STS probe stSG70243 for tudor domain containing 1 (TDRD1) and 1 more gene

Synopsis

Field NameValues
NamestSG70243
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesTDRD1; TDRD1
UniSTS IDUniSTS:181802

Sequences

>Probe|12415736|PRIMERF Forward PCR primer (outermost) (20b)
AAATGTGCAGTGCTCTCGTG
>Probe|12415736|PRIMERR Reverse PCR primer (outermost) (20b)
AACCAGTCTGGCCTCAAATG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map10 cmstSG70243

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID181802
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk