Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012415735

Eukaryota (3 taxa) STS probe stSG69827 for cubilin (intrinsic factor-cobalamin receptor) (CUBN) and 2 more genes

Synopsis

Field NameValues
NamestSG69827
TypeSTS
Application
Source organism
Source sequence
Target organismsPan troglodytes; Pongo abelii; Homo sapiens
Target genesLOC100445117 (Pongo abelii); CUBN (Pan troglodytes); CUBN (Homo sapiens)

Sequences

>Probe|12415735|PRIMERF Forward PCR primer (outermost) (20b)
GGGACGTACCTGCTTTGTCA
>Probe|12415735|PRIMERR Reverse PCR primer (outermost) (22b)
TATTAGGATCCACTGCAGGAGG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map10 cmstSG69827

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID181801
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk