Display Settings:

Format

Send to:

Choose Destination
Pr012415707

STS probe stSG12383 for high mobility group nucleosomal binding domain 2 pseudogene 28 (HMGN2P28) and 1 more gene

Synopsis

Field NameValues
NamestSG12383
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesHMGN2P28; GMDS-AS1
UniSTS IDUniSTS:181777

Sequences

>Probe|12415707|PRIMERF Forward PCR primer (outermost) (22b)
CAAGATCAGGTAAAAGGCAAGG
>Probe|12415707|PRIMERR Reverse PCR primer (outermost) (20b)
CTTGTGTGGCATTGTTTTGG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map6 cmstSG12383

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID181777
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk