Display Settings:

Format

Send to:

Choose Destination
Pr012415307

STS probe bac51052T for F-box and WD repeat domain containing 11 (FBXW11) and 3 more genes

Synopsis

Field NameValues
Namebac51052T
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesFBXW11; FBXW11; FBXW11; FBXW11
UniSTS IDUniSTS:181416

Sequences

>Probe|12415307|PRIMERF Forward PCR primer (outermost) (23b)
AGGTGACTTTAGACTTTCTGGCC
>Probe|12415307|PRIMERR Reverse PCR primer (outermost) (30b)
CATTCATCATGTATGTAAATATGTACACAC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map5 cmbac51052T

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID181416
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk