Display Settings:

Format

Send to:

Choose Destination
Pr012413041

STS probe D44480 for neurogenic differentiation 6 (Neurod6) and 1 more gene

Synopsis

Field NameValues
NameD44480
AliasesND
TypeSTS
Application
Source organism
Source sequence
Target organismMus musculus
Target genesNeurod6; Neurod6
UniSTS IDUniSTS:179377

Sequences

>Probe|12413041|PRIMERF Forward PCR primer (outermost) (20b)
GATGCTTGTGGGCTGAGTAA
>Probe|12413041|PRIMERR Reverse PCR primer (outermost) (20b)
GACAAGAGGGAAGGAAAGGA

References

1.

A radiation hybrid map of mouse genes.

Hudson TJ, Church DM, Greenaway S, Nguyen H, Cook A, Steen RG, Van Etten WJ, Castle AB, Strivens MA, Trickett P, Heuston C, Davison C, Southwell A, Hardisty R, Varela-Carver A, Haynes AR, Rodriguez-Tome P, Doi H, Ko MS, Pontius J, Schriml L, Wagner L, Maglott D, Brown SD, Lander ES, Schuler G, Denny P.

Nat Genet. 2001 Oct;29(2):201-5.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Mus musculusradiation hybridWI/MRC-RH6550.94 crD44480

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refRGD:5027313
UniSTS IDcontext specific help for: UniSTS ID179377
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk