Display Settings:

Format

Send to:

Choose Destination
Pr012412619

STS probe D25540 for transforming growth factor, beta receptor I (Tgfbr1)

Synopsis

Field NameValues
NameD25540
AliasesND
TypeSTS
Application
Source organism
Source sequence
Target organismMus musculus
Target geneTgfbr1
UniSTS IDUniSTS:178997

Sequences

>Probe|12412619|PRIMERF Forward PCR primer (outermost) (20b)
GTGCACAGCTCCTTCACACT
>Probe|12412619|PRIMERR Reverse PCR primer (outermost) (20b)
CAGGACTTAACACCGCCTTT

References

1.

A radiation hybrid map of mouse genes.

Hudson TJ, Church DM, Greenaway S, Nguyen H, Cook A, Steen RG, Van Etten WJ, Castle AB, Strivens MA, Trickett P, Heuston C, Davison C, Southwell A, Hardisty R, Varela-Carver A, Haynes AR, Rodriguez-Tome P, Doi H, Ko MS, Pontius J, Schriml L, Wagner L, Maglott D, Brown SD, Lander ES, Schuler G, Denny P.

Nat Genet. 2001 Oct;29(2):201-5.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Mus musculusradiation hybridWI/MRC-RH4744.2 crD25540

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID178997
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk