Display Settings:

Format

Send to:

Choose Destination
Pr012412397

Mus musculus STS probe AB000494 for potassium voltage-gated channel, subfamily Q, member 2 (Kcnq2)

Synopsis

Field NameValues
NameAB000494
Aliases685309
TypeSTS
Application
Source organism
Source sequence
Target organismMus musculus
Target geneKcnq2 (Mus musculus)
UniSTS IDUniSTS:178797

Sequences

>Probe|12412397|PRIMERF Forward PCR primer (outermost) (20b)
TGATATGTGTGCTGTGTGGG
>Probe|12412397|PRIMERR Reverse PCR primer (outermost) (20b)
CCACTGGGCATCTGAACTTA

References

1.

A radiation hybrid map of mouse genes.

Hudson TJ, Church DM, Greenaway S, Nguyen H, Cook A, Steen RG, Van Etten WJ, Castle AB, Strivens MA, Trickett P, Heuston C, Davison C, Southwell A, Hardisty R, Varela-Carver A, Haynes AR, Rodriguez-Tome P, Doi H, Ko MS, Pontius J, Schriml L, Wagner L, Maglott D, Brown SD, Lander ES, Schuler G, Denny P.

Nat Genet. 2001 Oct;29(2):201-5.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Mus musculusradiation hybridWI/MRC-RH22023.24 cr685309

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refRGD:5027241
UniSTS IDcontext specific help for: UniSTS ID178797
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk