Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012412015

Mus musculus STS probe X69867 for 5-hydroxytryptamine (serotonin) receptor 5B (Htr5b) and 4 more genes

Synopsis

Field NameValues
NameX69867
AliasesND
TypeSTS
Application
Source organism
Source sequence
Target organismMus musculus
Target genesGm15393 (Mus musculus); LOC100046900 (Mus musculus); Htr5b (Mus musculus); LOC620618 (Mus musculus); LOC637619 (Mus musculus)

Sequences

>Probe|12412015|PRIMERF Forward PCR primer (outermost) (20b)
ATCCTCATTTCACCCGAGAC
>Probe|12412015|PRIMERR Reverse PCR primer (outermost) (20b)
TGTAGAAGGCATGGGTGTGT

References

1.

A radiation hybrid map of mouse genes.

Hudson TJ, Church DM, Greenaway S, Nguyen H, Cook A, Steen RG, Van Etten WJ, Castle AB, Strivens MA, Trickett P, Heuston C, Davison C, Southwell A, Hardisty R, Varela-Carver A, Haynes AR, Rodriguez-Tome P, Doi H, Ko MS, Pontius J, Schriml L, Wagner L, Maglott D, Brown SD, Lander ES, Schuler G, Denny P.

Nat Genet. 2001 Oct;29(2):201-5.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Mus musculusradiation hybridWI/MRC-RH11631.48 crX69867

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID178452
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk