Display Settings:

Format

Send to:

Choose Destination
Pr012406087

Pan troglodytes and Homo sapiens STS probe SHGC-149157 for GTPase activating Rap/RanGAP domain-like 3 (GARNL3) and 1 more gene

Synopsis

Field NameValues
NameSHGC-149157
TypeSTS
Application
Source organism
Source sequence
Target organismsPan troglodytes; Homo sapiens
Target genesGARNL3 (Pan troglodytes); GARNL3 (Homo sapiens)
UniSTS IDUniSTS:173115

Sequences

>Probe|12406087|PRIMERF Forward PCR primer (outermost) (23b)
ATCCAAGGAGACTTTTCTGTCCC
>Probe|12406087|PRIMERR Reverse PCR primer (outermost) (23b)
AGTGTGACACATTGGTGCAGAGT

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map9 cmSHGC-149157

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID173115
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk