Display Settings:

Format

Send to:

Choose Destination
Pr012405176

STS probe SHGC-144586 for tuberous sclerosis 1 (TSC1) and 4 more genes

Synopsis

Field NameValues
NameSHGC-144586
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesTSC1; TSC1; TSC1; TSC1; TSC1
UniSTS IDUniSTS:172296

Sequences

>Probe|12405176|PRIMERF Forward PCR primer (outermost) (23b)
TGTTACTTTGTCCCCAAGGATGT
>Probe|12405176|PRIMERR Reverse PCR primer (outermost) (23b)
GACACCATACTTGTGGTGGTTCA

References

1.

A high-resolution radiation hybrid map of the human genome draft sequence.

Olivier M, Aggarwal A, Allen J, Almendras AA, Bajorek ES, Beasley EM, Brady SD, Bushard JM, Bustos VI, Chu A, Chung TR, De Witte A, Denys ME, Dominguez R, Fang NY, Foster BD, Freudenberg RW, Hadley D, Hamilton LR, Jeffrey TJ, Kelly L, Lazzeroni L, Levy MR, Lewis SC, Liu X, Lopez FJ, Louie B, Marquis JP, Martinez RA, Matsuura MK, Misherghi NS, Norton JA, Olshen A, Perkins SM, Perou AJ, Piercy C, Piercy M, Qin F, Reif T, Sheppard K, Shokoohi V, Smick GA, Sun WL, Stewart EA, Fernando J, Tejeda, Tran NM, Trejo T, Vo NT, Yan SC, Zierten DL, Zhao S, Sachidanandam R, Trask BJ, Myers RM, Cox DR.

Science. 2001 Feb 16;291(5507):1298-302.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridTNG951614 cr50000SHGC-144586
Homo sapienslinkageRutgers Map9 cmSHGC-144586

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID172296
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center