Display Settings:

Format

Send to:

Choose Destination
Pr012398404

Homo sapiens STS probe D22S1140

Synopsis

Field NameValues
NameD22S1140
AliasesAFMA142ZF5; AFMa142zf5; HSA142ZF5; RH31507; SHGC-21184
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
UniSTS IDUniSTS:16620

Sequences

>Probe|12398404|PRIMERF Forward PCR primer (outermost) (20b)
AGTGTCCCCATCTGAATATG
>Probe|12398404|PRIMERR Reverse PCR primer (outermost) (16b)
TCTGGTGTACGCGCAC

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Show All 5 References...

3.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

4.

A comprehensive genetic map of the human genome based on 5,264 microsatellites.

Dib C, Fauré S, Fizames C, Samson D, Drouot N, Vignal A, Millasseau P, Marc S, Hazan J, Seboun E, Lathrop M, Gyapay G, Morissette J, Weissenbach J.

Nature. 1996 Mar 14;380(6570):152-4.

5.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G3221475 cr10000SHGC-21184
Homo sapiensradiation hybridGeneMap99-G3221475 cr10000AFMa142zf5
Homo sapienslinkageRutgers Map22 cmD22S1140
Homo sapienslinkageMarshfield2249.37 cmAFMa142zf5
Homo sapienslinkageGenethon2243.3 cmAFMa142zf5
Homo sapiensradiation hybridNCBI RH22214.4 crAFMa142zf5

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID16620
Probe Cross-refcontext specific help for: Probe Cross-refGDB:603734
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk