Display Settings:

Format

Send to:

Choose Destination
Pr012397526

STS probe SHGC-6042 for acyl-CoA synthetase medium-chain family member 5 (ACSM5) and 3 more genes

Synopsis

Field NameValues
NameSHGC-6042
AliasesRH34501
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesACSM5; ACSM5; LOC647786; ACSM5
UniSTS IDUniSTS:16541

Sequences

>Probe|12397526|PRIMERF Forward PCR primer (outermost) (20b)
AGTGGGACTCCATCTCAAAT
>Probe|12397526|PRIMERR Reverse PCR primer (outermost) (21b)
TCCCACATGTGAAGACTTATG

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G3161107 cr10000SHGC-6042
Homo sapienslinkageRutgers Map16 cmSHGC-6042

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID16541
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk