Display Settings:

Format

Send to:

Choose Destination
Pr012397381

STS probe D10S2205 for NUT family member 2D-like (LOC466136) and 14 more genes

Synopsis

Field NameValues
NameD10S2205
AliasesMR12584; WI-9874
TypeSTS
Application
Source organism
Source sequence
Target genesLOC100585893; LOC100588885; LOC100600724; LOC100607313; LOC466136; NUTM2G; LOC696420; LOC701886; NUTM2F; LOC735373; LOC738010; LOC741397; LOC744093; LOC745682More
UniSTS IDUniSTS:16528

Sequences

>Probe|12397381|PRIMERF Forward PCR primer (outermost) (20b)
AGTGGCCAGAAGTCGGTTTT
>Probe|12397381|PRIMERR Reverse PCR primer (outermost) (18b)
CAGAGGACAGGGCCCCTT

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refGDB:678489
UniSTS IDcontext specific help for: UniSTS ID16528
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk