Display Settings:

Format

Send to:

Choose Destination
Pr012396132

STS probe AI505244 for uridine-cytidine kinase 1 (Uck1) and 1 more gene

Synopsis

Field NameValues
NameAI505244
Aliases445178
TypeSTS
Application
Source organism
Source sequence
Target organismMus musculus
Target genesUck1; Pomt1
UniSTS IDUniSTS:164154

Sequences

>Probe|12396132|PRIMERF Forward PCR primer (outermost) (20b)
AGTGAATGGACGACACCTTG
>Probe|12396132|PRIMERR Reverse PCR primer (outermost) (20b)
ACAGCCACCCTCTGTAAACC

References

1.

A radiation hybrid map of mouse genes.

Hudson TJ, Church DM, Greenaway S, Nguyen H, Cook A, Steen RG, Van Etten WJ, Castle AB, Strivens MA, Trickett P, Heuston C, Davison C, Southwell A, Hardisty R, Varela-Carver A, Haynes AR, Rodriguez-Tome P, Doi H, Ko MS, Pontius J, Schriml L, Wagner L, Maglott D, Brown SD, Lander ES, Schuler G, Denny P.

Nat Genet. 2001 Oct;29(2):201-5.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Mus musculusradiation hybridWI/MRC-RH2537.59 cr445178

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID164154
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk