Display Settings:

Format

Send to:

Choose Destination
Pr012394441

Mus musculus STS probe RH125911 for CD97 antigen (Cd97) and 1 more gene

Synopsis

Field NameValues
NameRH125911
TypeSTS
Application
Source organism
Source sequence
Target organismMus musculus
Target genesCd97 (Mus musculus); Ddx39 (Mus musculus)
UniSTS IDUniSTS:162631

Sequences

>Probe|12394441|PRIMERF Forward PCR primer (outermost) (24b)
CAATATGATATTTAATTTTGTGTG
>Probe|12394441|PRIMERR Reverse PCR primer (outermost) (18b)
CAGTCCTAGGACAAAGGG

References

1.

A radiation hybrid map of mouse genes.

Hudson TJ, Church DM, Greenaway S, Nguyen H, Cook A, Steen RG, Van Etten WJ, Castle AB, Strivens MA, Trickett P, Heuston C, Davison C, Southwell A, Hardisty R, Varela-Carver A, Haynes AR, Rodriguez-Tome P, Doi H, Ko MS, Pontius J, Schriml L, Wagner L, Maglott D, Brown SD, Lander ES, Schuler G, Denny P.

Nat Genet. 2001 Oct;29(2):201-5.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Mus musculusradiation hybridWI/MRC-RH8995.2 crAA409984

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID162631
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk