Display Settings:

Format

Send to:

Choose Destination
Pr012394319

Mus musculus STS probe RH125772 for solute carrier family 35 (CMP-sialic acid transporter), member 1 (Slc35a1) and 1 more gene

Synopsis

Field NameValues
NameRH125772
TypeSTS
Application
Source organism
Source sequence
Target organismMus musculus
Target genesLOC100046775 (Mus musculus); Slc35a1 (Mus musculus)
UniSTS IDUniSTS:162520

Sequences

>Probe|12394319|PRIMERF Forward PCR primer (outermost) (27b)
AAAAAAGAAAGTATAAAAGCAGCTTAT
>Probe|12394319|PRIMERR Reverse PCR primer (outermost) (19b)
CTTCTCTTCTCAGAGTGAG

References

1.

A radiation hybrid map of mouse genes.

Hudson TJ, Church DM, Greenaway S, Nguyen H, Cook A, Steen RG, Van Etten WJ, Castle AB, Strivens MA, Trickett P, Heuston C, Davison C, Southwell A, Hardisty R, Varela-Carver A, Haynes AR, Rodriguez-Tome P, Doi H, Ko MS, Pontius J, Schriml L, Wagner L, Maglott D, Brown SD, Lander ES, Schuler G, Denny P.

Nat Genet. 2001 Oct;29(2):201-5.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Mus musculusradiation hybridWI/MRC-RH4581.01 crAA408150

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID162520
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk