Display Settings:

Format

Send to:

Choose Destination
Pr012392075

STS probe R58928 for ankyrin repeat domain 32 (ANKRD32) and 3 more genes

Synopsis

Field NameValues
NameR58928
AliasesIB3299
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesANKRD32; ANKRD32; ANKRD32; ANKRD32
UniSTS IDUniSTS:16050

Sequences

>Probe|12392075|PRIMERF Forward PCR primer (outermost) (20b)
AGTCAAATTCTACACCCTGG
>Probe|12392075|PRIMERR Reverse PCR primer (outermost) (20b)
TGACAGACTTTGCAGCCTTG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map5 cmR58928

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID16050
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk