Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012390237

Mus musculus and Rattus norvegicus STS probe AA960234 for MAP kinase-activated protein kinase 2 (Mapkapk2) and 1 more gene

Synopsis

Field NameValues
NameAA960234
Aliases333942
TypeSTS
Application
Source organism
Source sequence
Target organismsMus musculus; Rattus norvegicus
Target genesMapkapk2 (Mus musculus); Mapkapk2 (Rattus norvegicus)

Sequences

>Probe|12390237|PRIMERF Forward PCR primer (outermost) (20b)
CACCATCAAAGACATGGGAG
>Probe|12390237|PRIMERR Reverse PCR primer (outermost) (20b)
TGTCTTGACTCTGTCCCTGC

References

1.

A radiation hybrid map of mouse genes.

Hudson TJ, Church DM, Greenaway S, Nguyen H, Cook A, Steen RG, Van Etten WJ, Castle AB, Strivens MA, Trickett P, Heuston C, Davison C, Southwell A, Hardisty R, Varela-Carver A, Haynes AR, Rodriguez-Tome P, Doi H, Ko MS, Pontius J, Schriml L, Wagner L, Maglott D, Brown SD, Lander ES, Schuler G, Denny P.

Nat Genet. 2001 Oct;29(2):201-5.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Mus musculusradiation hybridWI/MRC-RH11721.91 cr333942

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refRGD:5028382
UniSTS IDcontext specific help for: UniSTS ID158846
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk