Display Settings:

Format

Send to:

Choose Destination
Pr012389176

STS probe GDB:585571 for CD24 molecule pseudogene 4 (CD24P4) and 5 more genes

Synopsis

Field NameValues
NameGDB:585571
TypeSTS
Application
Source organism
Source sequence
Target genesCD24; LOC100510177; LOC647456; LOC728512; TTTY14; CD24P4
UniSTS IDUniSTS:157891

Sequences

>Probe|12389176|PRIMERF Forward PCR primer (outermost) (33b)
GTTGGCCCCAAATCCAACTAATGCCGCCACCAA
>Probe|12389176|PRIMERR Reverse PCR primer (outermost) (30b)
TAGAAGACGTTTCTTGGCCTGAGTCTCTTA

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID157891
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk