Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012388966

Eukaryota (3 taxa) STS probe GDB:555915 for surfactant protein B (SFTPB) and 2 more genes

Synopsis

Field NameValues
NameGDB:555915
TypeSTS
Application
Source organism
Source sequence
Target organismsNomascus leucogenys; Pongo abelii; Homo sapiens
Target genesSFTPB (Pongo abelii); SFTPB (Nomascus leucogenys); SFTPB (Homo sapiens)

Sequences

>Probe|12388966|PRIMERF Forward PCR primer (outermost) (28b)
CTGCTGAAACAGCAAGACCAGTGGGTTG
>Probe|12388966|PRIMERR Reverse PCR primer (outermost) (28b)
GGATCCTCCTGCCTCGGCCTCCTAAGGT

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map2 cmGDB:555915

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID157701
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk