Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012388440

Eukaryota (17 taxa) STS probe GDB:435453 for potassium voltage-gated channel, shaker-related subfamily, member 1 (episodic ataxia with myokymia) (KCNA1) and 19 more genes

Synopsis

Field NameValues
NameGDB:435453
TypeSTS
Application
Source organism
Source sequence
Target organismsCricetulus griseus; Mus musculus; Rattus norvegicus; Cavia porcellus; Monodelphis domestica; Anolis carolinensis; Nomascus leucogenys; Callithrix jacchus; Macaca mulatta; Pan troglodytes; Pongo abelii; Homo sapiens; Canis lupus familiaris; Ailuropoda melanoleuca; Equus caballus; Sus scrofa; Bos taurus
Target genesKCNA1 (Monodelphis domestica); KCNA3 (Monodelphis domestica); KCNA1 (Sus scrofa); KCNA1 (Equus caballus); LOC100153675 (Sus scrofa); KCNA1 (Callithrix jacchus); KCNA1 (Pongo abelii); KCNA1 (Ailuropoda melanoleuca); kcna1 (Anolis carolinensis); KCNA1 (Nomascus leucogenys); LOC100586756 (Nomascus leucogenys); Kcna1 (Cavia porcellus); Kcna1 (Cricetulus griseus); Kcna1 (Mus musculus); Kcna1 (Rattus norvegicus); KCNA1 (Homo sapiens); KCNA1 (Pan troglodytes); KCNA1 (Canis lupus familiaris); KCNA1 (Bos taurus); KCNA1 (Macaca mulatta)

Sequences

>Probe|12388440|PRIMERF Forward PCR primer (outermost) (19b)
GAGGCCATGGAGAAGTTCC
>Probe|12388440|PRIMERR Reverse PCR primer (outermost) (21b)
CTACAGTGGTCATGGACACCA

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map12 cmGDB:435453

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID157228
Probe Cross-refcontext specific help for: Probe Cross-refRGD:5500392
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk