Display Settings:

Format

Send to:

Choose Destination
Pr012387141

STS probe GDB:201790 for solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 4 (SLC25A4) and 4 more genes

Synopsis

Field NameValues
NameGDB:201790
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesSLC25A4; SLC25A4; SLC25A4; SLC25A4; SLC25A4
UniSTS IDUniSTS:156059

Sequences

>Probe|12387141|PRIMERF Forward PCR primer (outermost) (23b)
CAGAGCTCACTGCCTGGATATGG
>Probe|12387141|PRIMERR Reverse PCR primer (outermost) (22b)
TGTCTGCTCTGACCTCTGGCAG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map4 cmGDB:201790

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID156059
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk