Display Settings:

Format

Send to:

Choose Destination
Pr012387130

STS probe GDB:199078 for phenylalanine hydroxylase (PAH)

Synopsis

Field NameValues
NameGDB:199078
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genePAH
UniSTS IDUniSTS:156049

Sequences

>Probe|12387130|PRIMERF Forward PCR primer (outermost) (20b)
GCCAGAACAACTGCTGGTTC
>Probe|12387130|PRIMERR Reverse PCR primer (outermost) (20b)
AATCATAAGTGTTCCCAGAC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map12 cmGDB:199078

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID156049
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk