Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012386804

Cricetulus griseus and Cavia porcellus STS probe D10S16 for nucleoporin 210kDa-like (Nup210l) and 1 more gene

Synopsis

Field NameValues
NameD10S16
AliasesD10S23
TypeSTS
Application
Source organism
Source sequence
Target organismsCricetulus griseus; Cavia porcellus
Target genesNup210l (Cavia porcellus); Ttc28 (Cricetulus griseus)

Sequences

>Probe|12386804|PRIMERF Forward PCR primer (outermost) (20b)
CAGCCTCTTGAGTAGCTGGG
>Probe|12386804|PRIMERR Reverse PCR primer (outermost) (20b)
GTCAGGAGTTCGAGACCAGC

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refGDB:193809
UniSTS IDcontext specific help for: UniSTS ID155756
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk