Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012385923

Eukaryota (3 taxa) STS probe GDB:177797 for tumor protein p53 (TP53) and 2 more genes

Synopsis

Field NameValues
NameGDB:177797
TypeSTS
Application
Source organism
Source sequence
Target organismsMacaca mulatta; Pan troglodytes; Homo sapiens
Target genesTP53 (Pan troglodytes); TP53 (Homo sapiens); TP53 (Macaca mulatta)

Sequences

>Probe|12385923|PRIMERF Forward PCR primer (outermost) (23b)
AATGGATGATTTGATGCTGTCCC
>Probe|12385923|PRIMERR Reverse PCR primer (outermost) (21b)
CGTGCAAGTCACAGACTTGGC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map17 cmGDB:177797

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID154963
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk