Display Settings:

Format

Send to:

Choose Destination
Pr012385884

Eukaryota (4 taxa) STS probe GDB:177555 for phenylalanine hydroxylase (PAH) and 3 more genes

Synopsis

Field NameValues
NameGDB:177555
TypeSTS
Application
Source organism
Source sequence
Target organismsNomascus leucogenys; Pan troglodytes; Pongo abelii; Homo sapiens
Target genesPAH (Pongo abelii); PAH (Nomascus leucogenys); PAH (Homo sapiens); PAH (Pan troglodytes)
UniSTS IDUniSTS:154928

Sequences

>Probe|12385884|PRIMERF Forward PCR primer (outermost) (20b)
GTTAGGTTTTCCTGTTCTGG
>Probe|12385884|PRIMERR Reverse PCR primer (outermost) (20b)
CTTATGTTGCAAAATTCCTC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map12 cmGDB:177555

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID154928
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk