Display Settings:

Format

Send to:

Choose Destination
Pr012385812

STS probe GDB:177365 for KRAS proto-oncogene, GTPase (KRAS) and 4 more genes

Synopsis

Field NameValues
NameGDB:177365
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesKRAS; KRAS; KRAS; KRAS; KRAS
UniSTS IDUniSTS:154863

Sequences

>Probe|12385812|PRIMERF Forward PCR primer (outermost) (25b)
TAAGGCCTGCTGAAAATGACTGAAT
>Probe|12385812|PRIMERR Reverse PCR primer (outermost) (24b)
CTCTATTGTTGGATCATATTCGTC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map12 cmGDB:177365

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID154863
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk