Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012385433

Eukaryota (6 taxa) STS probe D5S2312E for transmembrane emp24 protein transport domain containing 9 (TMED9) and 5 more genes

Synopsis

Field NameValues
NameD5S2312E
TypeSTS
Application
Source organism
Source sequence
Target organismsNomascus leucogenys; Callithrix jacchus; Macaca mulatta; Pan troglodytes; Pongo abelii; Homo sapiens
Target genesLOC100396543 (Callithrix jacchus); TMED9 (Pongo abelii); TMED9 (Nomascus leucogenys); TMED9 (Pan troglodytes); TMED9 (Homo sapiens); TMED9 (Macaca mulatta)

Sequences

>Probe|12385433|PRIMERF Forward PCR primer (outermost) (20b)
AGGTCTAGGCTGAAAGAGAG
>Probe|12385433|PRIMERR Reverse PCR primer (outermost) (20b)
AAGCCAGTCTTCTGTCTTCC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map5 cmD5S2312E

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID154520
Probe Cross-refcontext specific help for: Probe Cross-refGDB:625995
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk