Display Settings:

Format

Send to:

Choose Destination
Pr012384144

STS probe D16S2785 for nuclear pore complex interacting protein family, member B5 (NPIPB5)

Synopsis

Field NameValues
NameD16S2785
Aliasess329F7
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target geneNPIPB5
UniSTS IDUniSTS:153355

Sequences

>Probe|12384144|PRIMERF Forward PCR primer (outermost) (26b)
GGCGTATTCTTAGAACTAGTGACTGC
>Probe|12384144|PRIMERR Reverse PCR primer (outermost) (22b)
CATGCTGATTCCTTATCACCAC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map16 cmD16S2785

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID153355
Probe Cross-refcontext specific help for: Probe Cross-refGDB:567777
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk