Display Settings:

Format

Send to:

Choose Destination
Pr012384100

STS probe D16S2745 for chromosome 16 open reading frame 62 (C16orf62) and 3 more genes

Synopsis

Field NameValues
NameD16S2745
Aliass308B12
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesC16H16orf62; C2H16orf62; C16orf62; C20H16orf62
UniSTS IDUniSTS:153315

Sequences

>Probe|12384100|PRIMERF Forward PCR primer (outermost) (22b)
AAGGGAAGGAGAGGGAGAAAAG
>Probe|12384100|PRIMERR Reverse PCR primer (outermost) (22b)
CATGATTAGGCAGTAACAAGAG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map16 cmD16S2745

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID153315
Probe Cross-refcontext specific help for: Probe Cross-refGDB:567657
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk