Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012384072

Pan troglodytes and Nomascus leucogenys STS probe D16S2720 for nodal modulator 3-like (LOC453938) and 4 more genes

Synopsis

Field NameValues
NameD16S2720
Aliasess302E12
TypeSTS
Application
Source organism
Source sequence
Target organismsNomascus leucogenys; Pan troglodytes
Target genesNOMO2 (Nomascus leucogenys); LOC453938 (Pan troglodytes); NOMO1 (Pan troglodytes); LOC741220 (Pan troglodytes); LOC750535 (Pan troglodytes)

Sequences

>Probe|12384072|PRIMERF Forward PCR primer (outermost) (22b)
TTCAACCACAAGATGTCCCTGC
>Probe|12384072|PRIMERR Reverse PCR primer (outermost) (22b)
CACAGGACCCCTCTTTGCTTAA

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refGDB:567582
UniSTS IDcontext specific help for: UniSTS ID153290
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk