Display Settings:

Format

Send to:

Choose Destination
Pr012384045

STS probe D16S2696

Synopsis

Field NameValues
NameD16S2696
Aliasess1E5
TypeSTS
Application
Source organism
Source sequence
UniSTS IDUniSTS:153266

Sequences

>Probe|12384045|PRIMERF Forward PCR primer (outermost) (20b)
GAACTGTCCCCTCAACATCC
>Probe|12384045|PRIMERR Reverse PCR primer (outermost) (23b)
CGTCAGATATGTGTTTGTCATCC

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refGDB:567510
UniSTS IDcontext specific help for: UniSTS ID153266
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk