Display Settings:

Format

Send to:

Choose Destination
Pr012382448

STS probe D12S1274 for glutamate ionotropic receptor NMDA type subunit 2B (GRIN2B) and 3 more genes

Synopsis

Field NameValues
NameD12S1274
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesGRIN2B; GRIN2B; GRIN2B; GRIN2B
UniSTS IDUniSTS:151828

Sequences

>Probe|12382448|PRIMERF Forward PCR primer (outermost) (22b)
ACATTCTGTTCTAGCTTTGGCC
>Probe|12382448|PRIMERR Reverse PCR primer (outermost) (18b)
TGCACATGATTGGATGCC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map12 cmD12S1274

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID151828
Probe Cross-refcontext specific help for: Probe Cross-refGDB:456247
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk