Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012382352

Eukaryota (4 taxa) STS probe D15S749 for tau tubulin kinase 2 (TTBK2) and 3 more genes

Synopsis

Field NameValues
NameD15S749
TypeSTS
Application
Source organism
Source sequence
Target organismsNomascus leucogenys; Pan troglodytes; Pongo abelii; Homo sapiens
Target genesTTBK2 (Pongo abelii); TTBK2 (Nomascus leucogenys); TTBK2 (Homo sapiens); TTBK2 (Pan troglodytes)

Sequences

>Probe|12382352|PRIMERF Forward PCR primer (outermost) (20b)
TTACCGTGTACCTTCATCCA
>Probe|12382352|PRIMERR Reverse PCR primer (outermost) (20b)
ATACCAACATCAATTTCCCA

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map15 cmD15S749

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID151741
Probe Cross-refcontext specific help for: Probe Cross-refGDB:451300
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk