Display Settings:

Format

Send to:

Choose Destination
Pr012382235

STS probe D16S2547E for trans-golgi network vesicle protein 23 homolog B (S. cerevisiae) (TVP23B) and 14 more genes

Synopsis

Field NameValues
NameD16S2547E
AliasesBdy31d05
TypeSTS
Application
Source organism
Source sequence
Target genesNPIPB5; MKL2; LOC100455714; TVP23B; MKL2; LOC100597904; TVP23CP2; MKL2; LOC455050; TVP23B; MKL2; FAM18B1; LOC720323; LOC723493More
UniSTS IDUniSTS:151636

Sequences

>Probe|12382235|PRIMERF Forward PCR primer (outermost) (21b)
AAACAAAGCCAACACTCCTCG
>Probe|12382235|PRIMERR Reverse PCR primer (outermost) (19b)
GGTGCTACAAGGTGCCAAC

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refGDB:447057
UniSTS IDcontext specific help for: UniSTS ID151636
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk