Display Settings:

Format

Send to:

Choose Destination
Pr012381550

STS probe D5S1597E

Synopsis

Field NameValues
NameD5S1597E
TypeSTS
Application
Source organism
Source sequence
UniSTS IDUniSTS:151019

Sequences

>Probe|12381550|PRIMERF Forward PCR primer (outermost) (20b)
ACCTGTAGTCCCAGCTACTC
>Probe|12381550|PRIMERR Reverse PCR primer (outermost) (21b)
TCTTTGCTCACTGCAACCTCC

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refGDB:442857
UniSTS IDcontext specific help for: UniSTS ID151019
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk